The purpose of beautier is to create a valid BEAST2 XML input file
from its function argument. In this way, a scientific pipeline using
BEAST2 can be fully scripted, instead of using BEAUti's GUI.
First, beautier is loaded:
library(beautier)
A BEAST2 XML input file needs an alignment (as BEAST2 infers
phylogenies and parameters on DNA sequences). This demonstration uses
a testing FASTA file used by beautier:
fasta_filename <- get_beautier_path("test_output_0.fas")
We can display the alignment in the file:
image(ape::read.FASTA(fasta_filename))
Now we can create our XML file:
# The name of the file you intend to let BEAST2 run
output_filename <- tempfile(pattern = "beeast2", fileext = ".xml")
create_beast2_input_file(
fasta_filename,
output_filename
)
The file indeed is a BEAST2 input file:
cat(readLines(output_filename), quote = FALSE, sep = '\n')
## <?xml version="1.0" encoding="UTF-8" standalone="no"?><beast beautitemplate='Standard' beautistatus='' namespace="beast.core:beast.evolution.alignment:beast.evolution.tree.coalescent:beast.core.util:beast.evolution.nuc:beast.evolution.operators:beast.evolution.sitemodel:beast.evolution.substitutionmodel:beast.evolution.likelihood" required="" version="2.4">
##
##
## <data
## id="test_output_0"
## name="alignment">
## <sequence id="seq_t1" taxon="t1" totalcount="4" value="acttgttgcgactgcgcctg"/>
## <sequence id="seq_t2" taxon="t2" totalcount="4" value="acttattgcgactgaggccg"/>
## <sequence id="seq_t3" taxon="t3" totalcount="4" value="acttaatgcgaatgagcccg"/>
## <sequence id="seq_t4" taxon="t4" totalcount="4" value="aacgacccgcgatcggggat"/>
## <sequence id="seq_t5" taxon="t5" totalcount="4" value="acttgttgcgactgagcctg"/>
## </data>
##
##
##
##
##
##
##
##
##
## <map name="Uniform" >beast.math.distributions.Uniform</map>
## <map name="Exponential" >beast.math.distributions.Exponential</map>
## <map name="LogNormal" >beast.math.distributions.LogNormalDistributionModel</map>
## <map name="Normal" >beast.math.distributions.Normal</map>
## <map name="Beta" >beast.math.distributions.Beta</map>
## <map name="Gamma" >beast.math.distributions.Gamma</map>
## <map name="LaplaceDistribution" >beast.math.distributions.LaplaceDistribution</map>
## <map name="prior" >beast.math.distributions.Prior</map>
## <map name="InverseGamma" >beast.math.distributions.InverseGamma</map>
## <map name="OneOnX" >beast.math.distributions.OneOnX</map>
##
##
## <run id="mcmc" spec="MCMC" chainLength="10000000">
## <state id="state" storeEvery="5000">
## <tree id="Tree.t:test_output_0" name="stateNode">
## <taxonset id="TaxonSet.test_output_0" spec="TaxonSet">
## <alignment idref="test_output_0"/>
## </taxonset>
## </tree>
## <parameter id="birthRate.t:test_output_0" name="stateNode">1.0</parameter>
## </state>
##
## <init id="RandomTree.t:test_output_0" spec="beast.evolution.tree.RandomTree" estimate="false" initial="@Tree.t:test_output_0" taxa="@test_output_0">
## <populationModel id="ConstantPopulation0.t:test_output_0" spec="ConstantPopulation">
## <parameter id="randomPopSize.t:test_output_0" name="popSize">1.0</parameter>
## </populationModel>
## </init>
##
## <distribution id="posterior" spec="util.CompoundDistribution">
## <distribution id="prior" spec="util.CompoundDistribution">
## <distribution id="YuleModel.t:test_output_0" spec="beast.evolution.speciation.YuleModel" birthDiffRate="@birthRate.t:test_output_0" tree="@Tree.t:test_output_0"/>
## <prior id="YuleBirthRatePrior.t:test_output_0" name="distribution" x="@birthRate.t:test_output_0">
## <Uniform id="Uniform.100" name="distr" upper="Infinity"/>
## </prior>
## </distribution>
## <distribution id="likelihood" spec="util.CompoundDistribution" useThreads="true">
## <distribution id="treeLikelihood.test_output_0" spec="ThreadedTreeLikelihood" data="@test_output_0" tree="@Tree.t:test_output_0">
## <siteModel id="SiteModel.s:test_output_0" spec="SiteModel">
## <parameter id="mutationRate.s:test_output_0" estimate="false" name="mutationRate">1.0</parameter>
## <parameter id="gammaShape.s:test_output_0" estimate="false" name="shape">1.0</parameter>
## <parameter id="proportionInvariant.s:test_output_0" estimate="false" lower="0.0" name="proportionInvariant" upper="1.0">0.0</parameter>
## <substModel id="JC69.s:test_output_0" spec="JukesCantor"/>
## </siteModel>
## <branchRateModel id="StrictClock.c:test_output_0" spec="beast.evolution.branchratemodel.StrictClockModel">
## <parameter id="clockRate.c:test_output_0" estimate="false" name="clock.rate">1.0</parameter>
## </branchRateModel>
## </distribution>
## </distribution>
## </distribution>
##
## <operator id="YuleBirthRateScaler.t:test_output_0" spec="ScaleOperator" parameter="@birthRate.t:test_output_0" scaleFactor="0.75" weight="3.0"/>
##
## <operator id="YuleModelTreeScaler.t:test_output_0" spec="ScaleOperator" scaleFactor="0.5" tree="@Tree.t:test_output_0" weight="3.0"/>
##
## <operator id="YuleModelTreeRootScaler.t:test_output_0" spec="ScaleOperator" rootOnly="true" scaleFactor="0.5" tree="@Tree.t:test_output_0" weight="3.0"/>
##
## <operator id="YuleModelUniformOperator.t:test_output_0" spec="Uniform" tree="@Tree.t:test_output_0" weight="30.0"/>
##
## <operator id="YuleModelSubtreeSlide.t:test_output_0" spec="SubtreeSlide" tree="@Tree.t:test_output_0" weight="15.0"/>
##
## <operator id="YuleModelNarrow.t:test_output_0" spec="Exchange" tree="@Tree.t:test_output_0" weight="15.0"/>
##
## <operator id="YuleModelWide.t:test_output_0" spec="Exchange" isNarrow="false" tree="@Tree.t:test_output_0" weight="3.0"/>
##
## <operator id="YuleModelWilsonBalding.t:test_output_0" spec="WilsonBalding" tree="@Tree.t:test_output_0" weight="3.0"/>
##
## <logger id="tracelog" fileName="test_output_0.log" logEvery="1000" model="@posterior" sanitiseHeaders="true" sort="smart">
## <log idref="posterior"/>
## <log idref="likelihood"/>
## <log idref="prior"/>
## <log idref="treeLikelihood.test_output_0"/>
## <log id="TreeHeight.t:test_output_0" spec="beast.evolution.tree.TreeHeightLogger" tree="@Tree.t:test_output_0"/>
## <log idref="YuleModel.t:test_output_0"/>
## <log idref="birthRate.t:test_output_0"/>
## </logger>
##
## <logger id="screenlog" logEvery="1000">
## <log idref="posterior"/>
## <log id="ESS.0" spec="util.ESS" arg="@posterior"/>
## <log idref="likelihood"/>
## <log idref="prior"/>
## </logger>
##
## <logger id="treelog.t:test_output_0" fileName="$(tree).trees" logEvery="1000" mode="tree">
## <log id="TreeWithMetaDataLogger.t:test_output_0" spec="beast.evolution.tree.TreeWithMetaDataLogger" tree="@Tree.t:test_output_0"/>
## </logger>
##
## </run>
##
## </beast>
## FALSE
This XML input file can be read by BEAST2.