The purpose of beautier is to create a valid BEAST2 XML input file from its function argument. In this way, a scientific pipeline using BEAST2 can be fully scripted, instead of using BEAUti’s GUI.
beautier is part of the babette package suite (website at https://github.com/ropensci/babette). babette allows to use BEAST2 (and its tools) from R.
First, beautier is loaded:
A BEAST2 XML input file needs an alignment (as BEAST2 infers phylogenies and parameters on DNA sequences). This demonstration uses a testing FASTA file used by beautier:
We can display the alignment in the file:
Specify the filename for our XML file, here I use a temporary filename, so there is no need to clean up afterwards:
output_filename <- tempfile(pattern = "beast2", fileext = ".xml")
output_filename
[1] "/tmp/Rtmp5ynr9n/beast24b3a46f09092.xml"Now we can create our XML file. We do not specify any inference model, and just use the BEAUti default settings:
The file indeed is a BEAST2 input file:
readLines(output_filename)
[1] "<?xml version=\"1.0\" encoding=\"UTF-8\" standalone=\"no\"?><beast beautitemplate='Standard' beautistatus='' namespace=\"beast.core:beast.evolution.alignment:beast.evolution.tree.coalescent:beast.core.util:beast.evolution.nuc:beast.evolution.operators:beast.evolution.sitemodel:beast.evolution.substitutionmodel:beast.evolution.likelihood\" required=\"\" version=\"2.4\">"
[2] ""
[3] ""
[4] " <data"
[5] "id=\"test_output_0\""
[6] "name=\"alignment\">"
[7] " <sequence id=\"seq_t1\" taxon=\"t1\" totalcount=\"4\" value=\"acttgttgcgactgcgcctg\"/>"
[8] " <sequence id=\"seq_t2\" taxon=\"t2\" totalcount=\"4\" value=\"acttattgcgactgaggccg\"/>"
[9] " <sequence id=\"seq_t3\" taxon=\"t3\" totalcount=\"4\" value=\"acttaatgcgaatgagcccg\"/>"
[10] " <sequence id=\"seq_t4\" taxon=\"t4\" totalcount=\"4\" value=\"aacgacccgcgatcggggat\"/>"
[11] " <sequence id=\"seq_t5\" taxon=\"t5\" totalcount=\"4\" value=\"acttgttgcgactgagcctg\"/>"
[12] " </data>"
[13] ""
[14] ""
[15] " "
[16] ""
[17] ""
[18] " "
[19] ""
[20] ""
[21] " "
[22] "<map name=\"Uniform\" >beast.math.distributions.Uniform</map>"
[23] "<map name=\"Exponential\" >beast.math.distributions.Exponential</map>"
[24] "<map name=\"LogNormal\" >beast.math.distributions.LogNormalDistributionModel</map>"
[25] "<map name=\"Normal\" >beast.math.distributions.Normal</map>"
[26] "<map name=\"Beta\" >beast.math.distributions.Beta</map>"
[27] "<map name=\"Gamma\" >beast.math.distributions.Gamma</map>"
[28] "<map name=\"LaplaceDistribution\" >beast.math.distributions.LaplaceDistribution</map>"
[29] "<map name=\"prior\" >beast.math.distributions.Prior</map>"
[30] "<map name=\"InverseGamma\" >beast.math.distributions.InverseGamma</map>"
[31] "<map name=\"OneOnX\" >beast.math.distributions.OneOnX</map>"
[32] ""
[33] ""
[34] "<run id=\"mcmc\" spec=\"MCMC\" chainLength=\"10000000\">"
[35] " <state id=\"state\" storeEvery=\"5000\">"
[36] " <tree id=\"Tree.t:test_output_0\" name=\"stateNode\">"
[37] " <taxonset id=\"TaxonSet.test_output_0\" spec=\"TaxonSet\">"
[38] " <alignment idref=\"test_output_0\"/>"
[39] " </taxonset>"
[40] " </tree>"
[41] " <parameter id=\"birthRate.t:test_output_0\" name=\"stateNode\">1.0</parameter>"
[42] " </state>"
[43] ""
[44] " <init id=\"RandomTree.t:test_output_0\" spec=\"beast.evolution.tree.RandomTree\" estimate=\"false\" initial=\"@Tree.t:test_output_0\" taxa=\"@test_output_0\">"
[45] " <populationModel id=\"ConstantPopulation0.t:test_output_0\" spec=\"ConstantPopulation\">"
[46] " <parameter id=\"randomPopSize.t:test_output_0\" name=\"popSize\">1.0</parameter>"
[47] " </populationModel>"
[48] " </init>"
[49] ""
[50] " <distribution id=\"posterior\" spec=\"util.CompoundDistribution\">"
[51] " <distribution id=\"prior\" spec=\"util.CompoundDistribution\">"
[52] " <distribution id=\"YuleModel.t:test_output_0\" spec=\"beast.evolution.speciation.YuleModel\" birthDiffRate=\"@birthRate.t:test_output_0\" tree=\"@Tree.t:test_output_0\"/>"
[53] " <prior id=\"YuleBirthRatePrior.t:test_output_0\" name=\"distribution\" x=\"@birthRate.t:test_output_0\">"
[54] " <Uniform id=\"Uniform.100\" name=\"distr\" upper=\"Infinity\"/>"
[55] " </prior>"
[56] " </distribution>"
[57] " <distribution id=\"likelihood\" spec=\"util.CompoundDistribution\" useThreads=\"true\">"
[58] " <distribution id=\"treeLikelihood.test_output_0\" spec=\"ThreadedTreeLikelihood\" data=\"@test_output_0\" tree=\"@Tree.t:test_output_0\">"
[59] " <siteModel id=\"SiteModel.s:test_output_0\" spec=\"SiteModel\">"
[60] " <parameter id=\"mutationRate.s:test_output_0\" estimate=\"false\" name=\"mutationRate\">1.0</parameter>"
[61] " <parameter id=\"gammaShape.s:test_output_0\" estimate=\"false\" name=\"shape\">1.0</parameter>"
[62] " <parameter id=\"proportionInvariant.s:test_output_0\" estimate=\"false\" lower=\"0.0\" name=\"proportionInvariant\" upper=\"1.0\">0.0</parameter>"
[63] " <substModel id=\"JC69.s:test_output_0\" spec=\"JukesCantor\"/>"
[64] " </siteModel>"
[65] " <branchRateModel id=\"StrictClock.c:test_output_0\" spec=\"beast.evolution.branchratemodel.StrictClockModel\">"
[66] " <parameter id=\"clockRate.c:test_output_0\" estimate=\"false\" name=\"clock.rate\">1.0</parameter>"
[67] " </branchRateModel>"
[68] " </distribution>"
[69] " </distribution>"
[70] " </distribution>"
[71] ""
[72] " <operator id=\"YuleBirthRateScaler.t:test_output_0\" spec=\"ScaleOperator\" parameter=\"@birthRate.t:test_output_0\" scaleFactor=\"0.75\" weight=\"3.0\"/>"
[73] ""
[74] " <operator id=\"YuleModelTreeScaler.t:test_output_0\" spec=\"ScaleOperator\" scaleFactor=\"0.5\" tree=\"@Tree.t:test_output_0\" weight=\"3.0\"/>"
[75] ""
[76] " <operator id=\"YuleModelTreeRootScaler.t:test_output_0\" spec=\"ScaleOperator\" rootOnly=\"true\" scaleFactor=\"0.5\" tree=\"@Tree.t:test_output_0\" weight=\"3.0\"/>"
[77] ""
[78] " <operator id=\"YuleModelUniformOperator.t:test_output_0\" spec=\"Uniform\" tree=\"@Tree.t:test_output_0\" weight=\"30.0\"/>"
[79] ""
[80] " <operator id=\"YuleModelSubtreeSlide.t:test_output_0\" spec=\"SubtreeSlide\" tree=\"@Tree.t:test_output_0\" weight=\"15.0\"/>"
[81] ""
[82] " <operator id=\"YuleModelNarrow.t:test_output_0\" spec=\"Exchange\" tree=\"@Tree.t:test_output_0\" weight=\"15.0\"/>"
[83] ""
[84] " <operator id=\"YuleModelWide.t:test_output_0\" spec=\"Exchange\" isNarrow=\"false\" tree=\"@Tree.t:test_output_0\" weight=\"3.0\"/>"
[85] ""
[86] " <operator id=\"YuleModelWilsonBalding.t:test_output_0\" spec=\"WilsonBalding\" tree=\"@Tree.t:test_output_0\" weight=\"3.0\"/>"
[87] ""
[88] " <logger id=\"tracelog\" fileName=\"test_output_0.log\" logEvery=\"1000\" model=\"@posterior\" sanitiseHeaders=\"true\" sort=\"smart\">"
[89] " <log idref=\"posterior\"/>"
[90] " <log idref=\"likelihood\"/>"
[91] " <log idref=\"prior\"/>"
[92] " <log idref=\"treeLikelihood.test_output_0\"/>"
[93] " <log id=\"TreeHeight.t:test_output_0\" spec=\"beast.evolution.tree.TreeHeightLogger\" tree=\"@Tree.t:test_output_0\"/>"
[94] " <log idref=\"YuleModel.t:test_output_0\"/>"
[95] " <log idref=\"birthRate.t:test_output_0\"/>"
[96] " </logger>"
[97] ""
[98] " <logger id=\"screenlog\" logEvery=\"1000\">"
[99] " <log idref=\"posterior\"/>"
[100] " <log id=\"ESS.0\" spec=\"util.ESS\" arg=\"@posterior\"/>"
[101] " <log idref=\"likelihood\"/>"
[102] " <log idref=\"prior\"/>"
[103] " </logger>"
[104] ""
[105] " <logger id=\"treelog.t:test_output_0\" fileName=\"$(tree).trees\" logEvery=\"1000\" mode=\"tree\">"
[106] " <log id=\"TreeWithMetaDataLogger.t:test_output_0\" spec=\"beast.evolution.tree.TreeWithMetaDataLogger\" tree=\"@Tree.t:test_output_0\"/>"
[107] " </logger>"
[108] ""
[109] "</run>"
[110] ""
[111] "</beast>" This XML input file can be read by BEAST2.
You can use beastier to run BEAST2 from R, see https://github.com/ropensci/beastier. You can use babette to do a BEAST2 inference directly, see https://github.com/ropensci/babette.